PrimePCR™ Variant Mutation Detection Assay: ORF8 Q27stop, SARS-CoV-2

PrimePCR

The PrimePCR SARS-CoV-2 Single Mutation Assay are single-tube mutation detection assays designed to detect specific mutations in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome. Assays contain unlabeled PCR primers and different dye-labeled, allele-specific probes plus a primer and probe combination for internal positive control.

Info:   Assay differentiates between reference and Q27stop allele and includes an internal amplification control primer/probe assay.

 
Fluorophore:   FAM,HEX,CY5
List Price:    $939.00
Your Price:   Log In
 

Assay Information

Technology:   qPCR
Assay Type:   Probe
Application:   Variant Mutation Detection
Unique Assay ID:   qSC2Mut0020201
Amplicon Length:   69
Nucleotide Mutation Detection:   27972C>T
Amino Acid Change:   Q27stop
MIQE Context :question   CTTAGGAATCATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACT[C/T]AACATCAACCATATGTAGTTGATGACCCGTGTCCTATTCACTTCTATTCTAAATGGTATAT

Gene Information

The Orf8 gene spans 366 nucleotides and encodes a 121 amino acid-long ORF8 protein. This gene resides in a hypervariable region of the viral genome that undergoes recombination and is prone to deletions and nucleotide substitutions. Sequence variation in ORF8 may be responsible for the emergence of the virus as a deadly human pathogen.

Gene Symbol:   ORF8
Gene Name:   ORF8
RefSeq:   NC_045512.2
Ensembl:   ENSSASG00005000008
Entrez:   43740577

[ Close ]
Click here to print
[ Close ]
Click here to print
 

undefined

undefined

My PrimePCR Hot List stores your saved PrimePCR products and configurations

My PrimePCR Hot List stores your saved PrimePCR products and configurations

undefined

undefined