PrimePCR™ Variant Mutation Detection Assay: ORF8 R52I, SARS-CoV-2

PrimePCR

The PrimePCR SARS-CoV-2 Single Mutation Assay are single-tube mutation detection assays designed to detect specific mutations in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome. Assays contain unlabeled PCR primers and different dye-labeled, allele-specific probes plus a primer and probe combination for internal positive control.

Info:   Assay differentiates between reference and R52I allele and includes an internal amplification control primer/probe assay.

 
Fluorophore:   FAM,HEX,CY5
List Price:    $939.00
Your Price:   Log In
 

Assay Information

Technology:   qPCR
Assay Type:   Probe
Application:   Variant Mutation Detection
Unique Assay ID:   qSC2Mut0020202
Amplicon Length:   78
Nucleotide Mutation Detection:   28048G>T
Amino Acid Change:   R52I
MIQE Context :question   GTAGTTGATGACCCGTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTA[G/T]AAAATCAGCACCTTTAATTGAATTGTGCGTGGATGAGGCTGGTTCTAAATCACCCATTCAG

Gene Information

The Orf8 gene spans 366 nucleotides and encodes a 121 amino acid-long ORF8 protein. This gene resides in a hypervariable region of the viral genome that undergoes recombination and is prone to deletions and nucleotide substitutions. Sequence variation in ORF8 may be responsible for the emergence of the virus as a deadly human pathogen.

Gene Symbol:   ORF8
Gene Name:   ORF8
RefSeq:   NC_045512.2
Ensembl:   ENSSASG00005000008
Entrez:   43740577

Type :   gBlock Gene Fragments
For instructions on preparing the positive controls, please see the assay instruction manual.
Sequence :  

Click Here to select the positive control sequence. Then to copy it to your clipboard, press Ctrl + C for Windows users or ⌘ + C for Mac users.

   
Copy the above positive control sequence and go to the link below and paste to order.
Order from IDT:   https://www.idtdna.com/site/Order/gblockentry
Number Description Download
10039761 PrimePCR™ Assays Quick Guide, Ver B Click to download
10042030 PrimePCR™ PreAmp Assay Quick Guide, Rev A Click to download
10000088666 Instruction Manual, PrimePCR Assays, Panels, and Controls, Ver G Click to download
10000143205 SARS-CoV-2 Variant Detection RT-PCR Assay Protocol Click to download
3226 PIS_PrimePCR SARS-CoV-2 Single and Multiple Mutation Assays Click to download
10000147102 PrimePCR SARS-CoV-2 Multiple Mutation Assay Protocol Click to download