PrimePCR™ Variant Mutation Detection Assay: S D80A, SARS-CoV-2

PrimePCR

The PrimePCR SARS-CoV-2 Single Mutation Assay are single-tube mutation detection assays designed to detect specific mutations in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome. Assays contain unlabeled PCR primers and different dye-labeled, allele-specific probes plus a primer and probe combination for internal positive control.

Info:   Assay differentiates between reference and D80A allele and includes an internal amplification control primer/probe assay.

 
Fluorophore:   FAM,HEX,CY5
List Price:    $916.00
Your Price:   Log In
 

Wet Lab Validated

Assay Information

Technology:   qPCR
Assay Type:   Probe
Application:   Variant Mutation Detection
Unique Assay ID:   qSC2Mut0020207
Amplicon Length:   70
Nucleotide Mutation Detection:   21801A>C
Amino Acid Change:   D80A
MIQE Context :question   TCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTG[A/C]TAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATA

Gene Information

The S gene is a 3822 nucleotide sequence that encodes a glycoprotein responsible for the invasion of host cells. This spike protein consisted of two subunits: S1 contains a receptor-binding domain that binds to ACE2 on the host cell membrane, and S2 mediates fusion between the cell membranes of the virus and the cell. Mutations in either domain of the spike protein may impact the virus’ transmissibility or infectivity.

Gene Symbol:   S
Gene Name:   Surface Glycoprotein
Aliases:   GU280_gp02, spike glycoprotein
RefSeq:   NC_045512.2
Ensembl:   ENSSASG00005000004
Entrez:   43740568

[ Close ]
Click here to print
[ Close ]
Click here to print
 

undefined

undefined

My PrimePCR Hot List stores your saved PrimePCR products and configurations

My PrimePCR Hot List stores your saved PrimePCR products and configurations

undefined

undefined