PrimePCR™ Variant Mutation Detection Assay: ORF1ab K3353R, SARS-CoV-2

PrimePCR

The PrimePCR SARS-CoV-2 Single Mutation Assay are single-tube mutation detection assays designed to detect specific mutations in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome. Assays contain unlabeled PCR primers and different dye-labeled, allele-specific probes plus a primer and probe combination for internal positive control.

Info:   Assay differentiates between reference and K3353R allele and includes an internal amplification control primer/probe assay.

 
Fluorophore:   FAM,HEX,CY5
List Price:    $916.00
Your Price:   Log In
 

Assay Information

Technology:   qPCR
Assay Type:   Probe
Application:   Variant Mutation Detection
Unique Assay ID:   qSC2Mut0020211
Amplicon Length:   79
Nucleotide Mutation Detection:   10323A>G
Amino Acid Change:   K3353R
MIQE Context :question   GCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCTTA[A/G]GGTTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAG

Gene Information

The ORF1ab gene is a 21290 nucleotide sequence containing overlapping open reading frames that encode many non-structural proteins essential for replicating and transcribing the viral genome.

Gene Symbol:   ORF1ab
Gene Name:   ORF1ab
Aliases:   ORF1a polyprotein;ORF1ab polyprotein
RefSeq:   NC_045512.2
Ensembl:   ENSSASG00005000002
Entrez:   43740578

[ Close ]
Click here to print
[ Close ]
Click here to print
 

undefined

undefined

My PrimePCR Hot List stores your saved PrimePCR products and configurations

My PrimePCR Hot List stores your saved PrimePCR products and configurations

undefined

undefined