PrimePCR™ Variant Mutation Detection Assay: E P71L, SARS-CoV-2

PrimePCR

The PrimePCR SARS-CoV-2 Single Mutation Assay are single-tube mutation detection assays designed to detect specific mutations in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome. Assays contain unlabeled PCR primers and different dye-labeled, allele-specific probes plus a primer and probe combination for internal positive control.

Info:   Assay differentiates between reference and P71L allele and includes an internal amplification control primer/probe assay.

 
Fluorophore:   FAM,HEX,CY5
List Price:    $916.00
Your Price:   Log In
Quantity:  
 

Assay Information

Technology:   qPCR
Assay Type:   Probe
Application:   Variant Mutation Detection
Unique Assay ID:   qSC2Mut0020216
Amplicon Length:   119
Nucleotide Mutation Detection:   26456C>T
Amino Acid Change:   P71L
MIQE Context :question   CTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTC[C/T]TGATCTTCTGGTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTT

Gene Information

The E gene is a short nucleotide sequence that encodes a short polypeptide that contains a transmembrane domain. This envelope protein is one of the major coronavirus structural proteins. This protein is responsible for virus assembly and plays a critical role in trafficking virions through the secretory pathway.

Gene Symbol:   E
Gene Name:   E
Aliases:   envelope protein
RefSeq:   NC_045512.2
Ensembl:   ENSSASG00005000010
Entrez:   43740570

Type :   gBlock Gene Fragments
For instructions on preparing the positive controls, please see the assay instruction manual.
Sequence :  

Click Here to select the positive control sequence. Then to copy it to your clipboard, press Ctrl + C for Windows users or ⌘ + C for Mac users.
   
Copy the above positive control sequence and go to the link below and paste to order.
Order from IDT:   https://www.idtdna.com/site/Order/gblockentry
Number Description Download
10039761 PrimePCR™ Assays Quick Guide, Ver B Click to download
10042030 PrimePCR™ PreAmp Assay Quick Guide, Rev A Click to download
10000088666 Instruction Manual, PrimePCR Assays, Panels, and Controls, Ver G Click to download
10000143205 SARS-CoV-2 Variant Detection RT-PCR Assay Protocol Click to download
3226 PIS_PrimePCR SARS-CoV-2 Single and Multiple Mutation Assays Click to download
10000147102 PrimePCR SARS-CoV-2 Multiple Mutation Assay Protocol Click to download