PrimePCR™ Multiple Mutation Detection Assay: S 417T, 452R, 478K, 501Y, SARS-CoV-2

PrimePCR

The PrimePCR SARS-CoV-2 Multiple Mutation RT-PCR Assay* is a multiplexed panel designed to detect and differentiate in a single well four key mutations identified in the severe respiratory syndrome coronavirus 2 (SARS-CoV-2) genome.

Info:   Assay detects K417T, L452R, T478K, and N501Y alleles and includes an internal amplification control primer/probe assay."

 
Fluorophore:   FAM, HEX, Texas Red, ATTO647, Cy5.5
List Price:    Inquire
Your Price:   Log In
 

Assay 2
Multiple Mutation Assay 2

SARS-CoV-2 Variant K417N L452R MPC T478K N501Y
Alpha (B.1.1.7)     X   X
Beta (B.1.351)     X   X
Delta (B.1.617.2)   X X X  
Epsilon (B.1.427/B.1.429)   X X    
Gamma (P.1) X   X    
Kappa (B.1.617.1/B.1.617.3)   X X    
Lambda (C.37)     X    
Omicron (B.1.1.529)     X X* X*

*Omicron has the T478K and N501Y mutations, but it may not be detected due to other mutations in the region


Assay Information

Technology:   qPCR
Assay Type:   Probe
Application:   Variant Mutation Detection
Unique Assay ID:   qSC2Mut0020223
Amplicon Length:   336
Nucleotide Mutation Detection:   22812A>C,22917T>G,22995C>A,23063A>T
Amino Acid Change:   417T, 452R, 478K, 501Y
MIQE Context :question   CTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAA[A/C]GATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACC[T/G]GTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCA[C/A]ACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACT[A/T]ATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATT

Gene Information

The S gene is a 3822 nucleotide sequence that encodes a glycoprotein responsible for the invasion of host cells. This spike protein consisted of two subunits: S1 contains a receptor-binding domain that binds to ACE2 on the host cell membrane, and S2 mediates fusion between the cell membranes of the virus and the cell. Mutations in either domain of the spike protein may impact the virus’ transmissibility or infectivity.

Gene Symbol:   S
Gene Name:   Surface Glycoprotein
Aliases:   GU280_gp02, spike glycoprotein
RefSeq:   NC_045512.2
Ensembl:   ENSSASG00005000004
Entrez:   43740568

[ Close ]
Click here to print
[ Close ]
Click here to print
 

undefined

undefined

My PrimePCR Hot List stores your saved PrimePCR products and configurations

My PrimePCR Hot List stores your saved PrimePCR products and configurations

undefined

undefined